microRNA OneArray® Microarray Performance
| Repeatability |

Figure 1: Log Ratio Correlation for Human & Primate microRNA OneArray® |
Array-to-array consistency is essential for making accurate comparisons of various experimental samples. Using our patented non-contact printing technology, we have produced an microRNA product line with outstanding repeatability.
Sample data from our Human & Primate microRNA OneArray® microarrays (Figure 1) shows a log2 intensity R^2=0.991 (raw signal intensity R^2=0.994) was obtained, showing excellent reproducibility. Pairwise intensity correlations for 10 microarrays show excellent results (Table 1). The microarrays were tested using Ambion Liver Total RNA enriched and labeled using the Ambion miRvana isolation and labeling kits. |
|
A |
B |
C |
D |
E |
F |
G |
H |
I |
J |
A |
1.000 |
0.991 |
0.986 |
0.993 |
0.988 |
0.987 |
0.990 |
0.977 |
0.990 |
0.990 |
B |
|
1.000 |
0.986 |
0.992 |
0.987 |
0.986 |
0.987 |
0.975 |
0.991 |
0.990 |
C |
|
|
1.000 |
0.989 |
0.981 |
0.984 |
0.983 |
0.969 |
0.989 |
0.986 |
D |
|
|
|
1.000 |
0.986 |
0.994 |
0.991 |
0.975 |
0.996 |
0.993 |
E |
|
|
|
|
1.000 |
0.980 |
0.983 |
0.971 |
0.985 |
0.985 |
F |
|
|
|
|
|
1.000 |
0.989 |
0.973 |
0.992 |
0.990 |
G |
|
|
|
|
|
|
1.000 |
0.976 |
0.988 |
0.989 |
H |
|
|
|
|
|
|
|
1.000 |
0.972 |
0.973 |
I |
|
|
|
|
|
|
|
|
1.000 |
0.993 |
J |
|
|
|
|
|
|
|
|
|
1.000 |
|
|
| Table 1: Pairwise intensity
correlation comparing 10 Human & Primate OneArray® microarrays. |
| Dynamic Range |

Figure 2: Sensitivity of Control Probes
|
Sensitivity and dynamic ranges define the lowest and highest boundaries of signal intensity obtained from the microarray that can accurately reflect the differences in amounts of targets present in a sample.
Many factors such as probe design, composition of hybridization buffer, surface chemistry, etc., can influence the sensitivity and dynamic range of the microarray.
The dynamic range of Phalanx Human & Primate microRNA OneArray was assayed using target RNAs complementary to the Phalanx negative control probes PH_mrc_000001 - PH_mrc_00005. These 'spike-in' target RNAs were labeled with Cy5™ using the Kreatech ULS™ microRNA Labeling Kit (EA-038). A linear dynamic range (R^2>0.98) was observed from 0.01 to 10 pM, showing excellent sensitivity and a dynamic range of 3-4 orders of magnitude.
|
| Specificity |
hsa-let-7a |
UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7b |
UGAGGUAGUAGGUUGUGUGGUU |
hsa-let-7c |
UGAGGUAGUAGGUUGUAUGGUU |
hsa-let-7d |
AGAGGUAGUAGGUUGCAUAGU_ |
hsa-let-7e |
UGAGGUAGGAGGUUGUAUAGU_ |
hsa-let-7f |
UGAGGUAGUAGAUUGUAUAGUU |
hsa-let-7g |
UGAGGUAGUAGUUUGUACAGU_ |
hsa-let-7i |
UGAGGUAGUAGUUUGUGCUGU_ |
|
Table 2: H. sapiens let microRNA family sequences.
|
Due to the short length of microRNAs, it is essential to detect small differences in sequence to gather biologically meaningful data. A well-known example of this sequence similarity is in the let family of human microRNAs. Table 2 depicts the mature microRNA sequences of the let family microRNAs (bases in RED show sequence divergence from let-7a).
The specificity of Phalanx Human & Primate microRNA OneArray® was measured using synthetic target RNAs from the let family. 1 ug of each oligo (hsa-let-7a to hsa-let-7i) was hybridized to a single microarray and the signal intensities of the let family probes were monitored to measure cross-hybridization. The signal values for each array were normalized to attribute a signal of 100% to the cognate pair, where all other values are a percentage of the cognate intensity. |
Phalanx Human & Primate microRNA OneArray |
Relative Probe Intensity |
hsa- let-7a |
hsa- let-7b |
hsa- let-7c |
hsa- let-7d |
hsa- let-7e |
hsa- let-7f |
hsa- let-7g |
hsa- let-7i |
Antisense RNA input
(1 ug) |
hsa- let-7a |
100 |
15 |
19 |
19 |
13 |
16 |
6 |
1 |
hsa- let-7b |
8 |
100 |
48 |
4 |
0 |
0 |
0 |
0 |
hsa- let-7c |
13 |
6 |
100 |
1 |
1 |
1 |
0 |
0 |
hsa- let-7d |
5 |
4 |
4 |
100 |
1 |
3 |
1 |
0 |
hsa- let-7e |
7 |
1 |
2 |
2 |
100 |
1 |
1 |
0 |
hsa- let-7f |
26 |
2 |
4 |
1 |
2 |
100 |
4 |
2 |
hsa- let-7g |
1 |
1 |
1 |
1 |
0 |
2 |
100 |
5 |
hsa- let-7i |
2 |
2 |
1 |
0 |
1 |
3 |
37 |
100 |
Table 3: Relative intensities of cross hybridization.
|
Color |
Relative Intensity Range |
White |
0-14 % |
Pink |
15-25 % |
Orange |
26-50 % |
Red |
51-100 % |
|